Stem-loop sequence cqu-mir-11

AccessionMI0013601 (change log)
DescriptionCulex quinquefasciatus miR-11 stem-loop
Gene family MIPF0000252; mir-11
Literature search

2 open access papers mention cqu-mir-11
(4 sentences)

Stem-loop
   gug   c          c        cc    ugccccg 
5'    ccg gcgagaacuc ggcuguga  ugug       u
      ||| |||||||||| ||||||||  ||||       g
3'    ggu cguucuugag cugacacu  acac       u
   ---   u          u        --    uucaagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CpipJ1) Overlapping transcripts
supercont3.153: 639666-639741 [-]
intergenic
Clustered miRNAs
< 10kb from cqu-mir-11
cqu-mir-11supercont3.153: 639666-639741 [-]
cqu-mir-998supercont3.153: 639506-639609 [-]
Database links

Mature sequence cqu-miR-11-5p

Accession MIMAT0014406
Previous IDscqu-miR-11*
Sequence

9 - 

cgagaacuccggcugugacc

 - 28

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cqu-miR-11-3p

Accession MIMAT0014407
Previous IDscqu-miR-11
Sequence

52 - 

caucacagucugaguucuugcu

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).