Stem-loop sequence cqu-mir-10

AccessionMI0013600 (change log)
DescriptionCulex quinquefasciatus miR-10 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   --          cu   -  g    u           ---  aau 
5'   uguucuacau  acc cu uaga ccgaauuuguu   ug   a
     ||||||||||  ||| || |||| |||||||||||   ||    
3'   acggggugug  ugg ga aucu ggcuuaaacag   ac   u
   uu          uu   a  g    u           cga  aaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CpipJ1) Overlapping transcripts
supercont3.12: 95988-96073 [-]
intergenic
Database links

Mature sequence cqu-miR-10-5p

Accession MIMAT0014404
Previous IDscqu-miR-10*
Sequence

13 - 

acccuguagauccgaauuuguu

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cqu-miR-10-3p

Accession MIMAT0014405
Previous IDscqu-miR-10
Sequence

52 - 

caaauucgguucuagagagguuu

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).