Stem-loop sequence cqu-mir-1000

AccessionMI0013599 (change log)
DescriptionCulex quinquefasciatus miR-1000 stem-loop
Gene family MIPF0000701; mir-1000
Literature search

1 open access papers mention cqu-mir-1000
(1 sentences)

Stem-loop
   --uuuu       aa    uauau       uc         --  uu 
5'       gcuagaa  cgau     uguccug  acagcagua  cu  u
         |||||||  ||||     |||||||  |||||||||  ||  c
3'       cgaucuu  guua     acagggc  uguugucau  ga  c
   cacugc       -a    cauuu       uu         uc  uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CpipJ1) Overlapping transcripts
supercont3.153: 102798-102891 [-]
intergenic
Database links

Mature sequence cqu-miR-1000

Accession MIMAT0014403
Sequence

19 - 

auauuguccugucacagcagu

 - 39

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).