Stem-loop sequence cqu-mir-190-2

AccessionMI0013597 (change log)
DescriptionCulex quinquefasciatus miR-190-2 stem-loop
Gene family MIPF0000076; mir-190
Literature search

1 open access papers mention cqu-mir-190-2
(1 sentences)

Stem-loop
   g      uc      -            au      u  u   auu 
5'  ggugau  cgguga gauauguuugau  ucuugg ug uaa   u
    ||||||  |||||| ||||||||||||  |||||| || |||    
3'  cuacug  gucauu uuauacaaacua  aggacc ac auu   u
   -      gu      a            --      c  u   aua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CpipJ1) Overlapping transcripts
supercont3.351: 105046-105135 [-]
intergenic
Database links

Mature sequence cqu-miR-190

Accession MIMAT0014402
Sequence

15 - 

agauauguuugauauucuugguug

 - 38

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).