Stem-loop sequence cqu-mir-71

AccessionMI0013596 (change log)
DescriptionCulex quinquefasciatus miR-71 stem-loop
Gene family MIPF0000278; mir-71
Stem-loop
   --     a        u            aguuuua   ugcauu 
5'   cggca gaaagaca ggguagugagau       ccc      c
     ||||| |||||||| ||||||||||||       |||       
3'   gucgu cuuucugu uccaucacucua       ggg      g
   ua     a        -            -------   ccaaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CpipJ1) Overlapping transcripts
supercont3.366: 117497-117578 [-]
intergenic
Clustered miRNAs
< 10kb from cqu-mir-71
cqu-mir-71supercont3.366: 117497-117578 [-]
cqu-mir-13supercont3.366: 116988-117069 [-]
cqu-mir-2supercont3.366: 116852-116935 [-]
Database links

Mature sequence cqu-miR-71-5p

Accession MIMAT0014400
Previous IDscqu-miR-71
Sequence

6 - 

agaaagacauggguagugagau

 - 27

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cqu-miR-71-3p

Accession MIMAT0014401
Previous IDscqu-miR-71*
Sequence

56 - 

ucucacuaccuugucuuucaug

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).