Stem-loop sequence cqu-mir-210

AccessionMI0013592 (change log)
DescriptionCulex quinquefasciatus miR-210 stem-loop
Gene family MIPF0000086; mir-210
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-210_microRNA. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-210 microRNA is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms. mir-210 has been strongly linked with the hypoxia pathway, and is upregulated in response to Hypoxia-inducible factors. It is also overexpressed in cells affected by cardiac disease and tumours. MiRNA-210 in particular, has been studied for its effects in rescuing cardiac function after myocardial infarcts via the up-regulation of angiogenesis and inhibition of cardiomyocyte apoptosis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   cucauugc     c  ac   -         -   g 
5'         agcug ug  cac ugcacaaga uua a
           ||||| ||  ||| ||||||||| ||| u
3'         ucggc ac  gug gcguguucu agu u
   ----guua     a  -a   u         c   a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CpipJ1) Overlapping transcripts
supercont3.549: 157655-157722 [-]
intergenic
Database links

Mature sequence cqu-miR-210-5p

Accession MIMAT0014396
Previous IDscqu-miR-210*
Sequence

9 - 

agcugcugaccacugcacaaga

 - 30

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cqu-miR-210-3p

Accession MIMAT0014397
Previous IDscqu-miR-210
Sequence

44 - 

cuugugcgugugacaacggcuau

 - 66

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).