Stem-loop sequence cqu-mir-12

AccessionMI0013591 (change log)
DescriptionCulex quinquefasciatus miR-12 stem-loop
Gene family MIPF0000181; mir-12
Literature search

1 open access papers mention cqu-mir-12
(2 sentences)

Stem-loop
   -----aa    -----     --c         cgu    c  aaagaaga  a  g 
5'        gaua     accug   uggugcuca   gucc ga        ag au a
          ||||     |||||   |||||||||   |||| ||        || ||  
3'        cugu     uggac   auuaugagu   uagg cu        uc ua a
   cuuauag    gguca     uac         ---    -  --gucccg  c  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CpipJ1) Overlapping transcripts
supercont3.57: 562944-563041 [+]
intergenic
Clustered miRNAs
< 10kb from cqu-mir-12
cqu-mir-283supercont3.57: 559440-559549 [+]
cqu-mir-1889supercont3.57: 562539-562677 [+]
cqu-mir-12supercont3.57: 562944-563041 [+]
Database links

Mature sequence cqu-miR-12-5p

Accession MIMAT0014394
Previous IDscqu-miR-12*
Sequence

39 - 

aagaaugaaaauccugcccugucggau

 - 65

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cqu-miR-12-3p

Accession MIMAT0014395
Previous IDscqu-miR-12
Sequence

66 - 

ugaguauuacaucagguacuggu

 - 88

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).