Stem-loop sequence cqu-mir-276-2

AccessionMI0013589 (change log)
DescriptionCulex quinquefasciatus miR-276-2 stem-loop
Gene family MIPF0000124; mir-276
Literature search

1 open access papers mention cqu-mir-276-2
(3 sentences)

Stem-loop
   ---c  --gugg     gauu    uc    a     ag         --   g  a 
5'     gu      uuggu    gcca  agcg gguau  aguuccuac  guu cg g
       ||      |||||    ||||  |||| |||||  |||||||||  ||| ||  
3'     ca      agccg    cggu  ucgu ccaua  ucaaggaug  uaa gc u
   aaaa  acuuaa     --au    uc    g     cu         gc   a  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CpipJ1) Overlapping transcripts
supercont3.136: 541130-541236 [+]
intergenic
Database links

Mature sequence cqu-miR-276-5p

Accession MIMAT0014392
Previous IDscqu-miR-276*
Sequence

23 - 

agcgagguauagaguuccu

 - 41

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cqu-miR-276-3p

Accession MIMAT0014393
Previous IDscqu-miR-276
Sequence

63 - 

uaggaacuucauaccgugcucu

 - 84

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).