Stem-loop sequence cqu-mir-1175

AccessionMI0013587 (change log)
DescriptionCulex quinquefasciatus miR-1175 stem-loop
Gene family MIPF0000715; mir-1175
Literature search

2 open access papers mention cqu-mir-1175
(4 sentences)

Stem-loop
   aaaaauuaucac        a     -    u     uc  a      agua 
5'             gauaugaa uaagu ggag agugg  uc ucgcuu    u
               |||||||| ||||| |||| |||||  || ||||||     
3'             uuauacuu auuca ccuc ucauc  ag agugaa    u
   -caaagcucgau        a     g    u     uu  -      aaga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CpipJ1) Overlapping transcripts
supercont3.86: 866094-866196 [+]
intergenic
Clustered miRNAs
< 10kb from cqu-mir-1175
cqu-mir-1174supercont3.86: 865899-865962 [+]
cqu-mir-1175supercont3.86: 866094-866196 [+]
Database links

Mature sequence cqu-miR-1175-5p

Accession MIMAT0014390
Previous IDscqu-miR-1175
Sequence

23 - 

aaguggaguaguggucucaucg

 - 44

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cqu-miR-1175-3p

Accession MIMAT0014391
Previous IDscqu-miR-1175*
Sequence

61 - 

ugagauucuacuucuccgacu

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).