Stem-loop sequence cqu-mir-981

AccessionMI0013584 (change log)
DescriptionCulex quinquefasciatus miR-981 stem-loop
Gene family MIPF0000710; mir-981
Literature search

1 open access papers mention cqu-mir-981
(1 sentences)

Stem-loop
   aa   -      -c  gau         -      a       uacugauu 
5'   aca ccuugu  ug   cggguuucg cggcaa cgggcug        c
     ||| ||||||  ||   ||||||||| |||||| |||||||         
3'   ugu ggaacg  ac   guccaaagc gcuguu gcuugac        g
   aa   u      uc  -ac         a      -       uaaaaagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CpipJ1) Overlapping transcripts
supercont3.431: 151310-151408 [+]
intergenic
Database links

Mature sequence cqu-miR-981

Accession MIMAT0014386
Sequence

62 - 

uucguugucgacgaaaccugca

 - 83

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).