Stem-loop sequence cqu-mir-317-1

AccessionMI0013583 (change log)
Previous IDscqu-mir-317
DescriptionCulex quinquefasciatus miR-317-1 stem-loop
Gene family MIPF0000144; mir-317
Literature search

1 open access papers mention cqu-mir-317-1
(5 sentences)

Stem-loop
   ga   a  uc      c       -   --     c     uugcau 
5'   gga uu  ggcuac gggauac acc  cugug ucgcu      u
     ||| ||  |||||| ||||||| |||  ||||| |||||       
3'   ccu ag  ccggug cucuaug ugg  gacac aguga      c
   ag   -  uc      a       g   uc     a     ucaaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CpipJ1) Overlapping transcripts
supercont3.36: 1133155-1133246 [+]
intergenic
Clustered miRNAs
< 10kb from cqu-mir-317-1
cqu-mir-317-1supercont3.36: 1133155-1133246 [+]
cqu-mir-317-2supercont3.36: 1134821-1134912 [+]
Database links

Mature sequence cqu-miR-317-5p

Accession MIMAT0014384
Previous IDscqu-miR-317*
Sequence

17 - 

cgggauacacccugugcucgcuuugc

 - 42

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cqu-miR-317-3p

Accession MIMAT0014385
Previous IDscqu-miR-317
Sequence

55 - 

ugaacacagcuggugguaucu

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).