Stem-loop sequence cqu-mir-9

AccessionMI0013581 (change log)
DescriptionCulex quinquefasciatus miR-9 stem-loop
Gene family MIPF0000014; mir-9
Stem-loop
   au   ua          c  a            cu    g     u  uga   ug 
5'   gcg  uaauuuccgg ug aucuuugguauu  agcu uagaa gu   gcu  u
     |||  |||||||||| || ||||||||||||  |||| ||||| ||   |||   
3'   cgu  guuaaggguc ac uggagaccauga  ucga aucuu ua   ugg  u
   gu   uc          a  c            uu    a     c  ---   ca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CpipJ1) Overlapping transcripts
supercont3.83: 64711-64821 [+]
intergenic
Database links

Mature sequence cqu-miR-9-5p

Accession MIMAT0014380
Previous IDscqu-miR-9
Sequence

23 - 

ucuuugguauucuagcuguaga

 - 44

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cqu-miR-9-3p

Accession MIMAT0014381
Previous IDscqu-miR-9*
Sequence

70 - 

uaaagcuuuaguaccagagguc

 - 91

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).