Stem-loop sequence cqu-mir-970

AccessionMI0013579 (change log)
DescriptionCulex quinquefasciatus miR-970 stem-loop
Gene family MIPF0000700; mir-970
Literature search

1 open access papers mention cqu-mir-970
(1 sentences)

Stem-loop
   au       a    g    u    u       gu     ugcau 
5'   accuuuu aaga aguu gcgu ugucuua  uggua     u
     ||||||| |||| |||| |||| |||||||  |||||      
3'   uggaaaa uuuu ucgg cgca acagaau  acuau     u
   uc       c    a    -    c       --     uaaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CpipJ1) Overlapping transcripts
supercont3.495: 35917-36003 [+]
intergenic
Database links

Mature sequence cqu-miR-970

Accession MIMAT0014378
Sequence

54 - 

ucauaagacacacgcggcuau

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).