Stem-loop sequence cqu-mir-278

AccessionMI0013578 (change log)
DescriptionCulex quinquefasciatus miR-278 stem-loop
Gene family MIPF0000155; mir-278
Literature search

1 open access papers mention cqu-mir-278
(3 sentences)

Stem-loop
   aa  -u     cuu   -            u     u  g     gugccauuu 
5'   gu  cuggu   ggu gcggacggacga agucu ca cgacc         g
     ||  |||||   ||| |||||||||||| ||||| || |||||         a
3'   cg  gaccg   cca uguuugccugcu ucagg gu gcugg         a
   aa  uu     ---   a            u     -  g     guuucccaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CpipJ1) Overlapping transcripts
supercont3.16: 1026146-1026250 [+]
intergenic
Database links

Mature sequence cqu-miR-278

Accession MIMAT0014377
Sequence

67 - 

ucggugggacuuucguccguuu

 - 88

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).