Stem-loop sequence cqu-mir-277

AccessionMI0013574 (change log)
DescriptionCulex quinquefasciatus miR-277 stem-loop
Gene family MIPF0000156; mir-277
Literature search

1 open access papers mention cqu-mir-277
(4 sentences)

Stem-loop
   ua           -   gu    -            ua      uuccc 
5'   guuuuggagug cgu  caga agugcauuuaca  gguauu     g
     ||||||||||| |||  |||| ||||||||||||  ||||||      
3'   uaagaccuuac gca  gucu ucacguaaaugu  uuauga     u
   ac           a   ug    a            --      cgauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CpipJ1) Overlapping transcripts
supercont3.36: 1153723-1153818 [+]
intergenic
Database links

Mature sequence cqu-miR-277

Accession MIMAT0014371
Sequence

63 - 

uaaaugcacuaucugguacgac

 - 84

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).