Stem-loop sequence cqu-mir-957

AccessionMI0013572 (change log)
DescriptionCulex quinquefasciatus miR-957 stem-loop
Gene family MIPF0000723; mir-957
Literature search

1 open access papers mention cqu-mir-957
(1 sentences)

Stem-loop
   aa      uu     g              g       -guau   g 
5'   ggccau  ccggc uuaguuuugggcgg uuuuagu     uuc a
     ||||||  ||||| |||||||||||||| |||||||     ||| u
3'   uuggug  ggucg agucaaaaccugcc aaaguua     gag g
   gc      gc     g              -       acuau   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CpipJ1) Overlapping transcripts
supercont3.787: 29533-29627 [+]
intergenic
Database links

Mature sequence cqu-miR-957

Accession MIMAT0014369
Sequence

61 - 

ugaaaccguccaaaacugaggc

 - 82

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).