Stem-loop sequence cqu-mir-13

AccessionMI0013571 (change log)
DescriptionCulex quinquefasciatus miR-13 stem-loop
Gene family MIPF0000049; mir-2
Stem-loop
        -gu    a            cc     uacau    a 
5' guuca   ucgu aaaaugguugug  gugug     uuga c
   |||||   |||| ||||||||||||  |||||     ||||  
3' caagu   agca uuuuaccgacac  uauac     aacu a
        uug    g            --     -uuau    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CpipJ1) Overlapping transcripts
supercont3.366: 116988-117069 [-]
intergenic
Clustered miRNAs
< 10kb from cqu-mir-13
cqu-mir-71supercont3.366: 117497-117578 [-]
cqu-mir-13supercont3.366: 116988-117069 [-]
cqu-mir-2supercont3.366: 116852-116935 [-]
Database links

Mature sequence cqu-miR-13

Accession MIMAT0014368
Sequence

55 - 

uaucacagccauuuugacgagu

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).