Stem-loop sequence cqu-mir-315

AccessionMI0013569 (change log)
DescriptionCulex quinquefasciatus miR-315 stem-loop
Gene family MIPF0000141; mir-315
Literature search

1 open access papers mention cqu-mir-315
(1 sentences)

Stem-loop
   - a      c   aaa                a      --c   cau 
5'  g guguuu uau   auuuugauuguugcuc gaaagc   gug   u
    | |||||| |||   |||||||||||||||| ||||||   |||   c
3'  c cacaaa aua   ugagacuaaugacgag cuuucg   uac   g
   a -      -   aac                -      ccu   aaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CpipJ1) Overlapping transcripts
supercont3.438: 61910-62002 [+]
intergenic
Database links

Mature sequence cqu-miR-315

Accession MIMAT0014365
Sequence

17 - 

uuuugauuguugcucagaaagc

 - 38

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).