Stem-loop sequence cqu-mir-275

AccessionMI0013568 (change log)
DescriptionCulex quinquefasciatus miR-275 stem-loop
Gene family MIPF0000187; mir-275
Literature search

2 open access papers mention cqu-mir-275
(4 sentences)

Stem-loop
   cc   aauc        a          -ag    a   gg    --    c 
5'   cgg    cuuccgau gcgcgcgcua   cagg acc  gacu  uggu a
     |||    |||||||| ||||||||||   |||| |||  ||||  |||| u
3'   gcc    gaaggcua ugcgcgcgau   gucc ugg  cuga  aucg u
   cc   --gu        g          gaa    a   -a    cg    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CpipJ1) Overlapping transcripts
supercont3.291: 329754-329854 [+]
intergenic
Clustered miRNAs
< 10kb from cqu-mir-275
cqu-mir-275supercont3.291: 329754-329854 [+]
cqu-mir-305supercont3.291: 339120-339207 [+]
Database links

Mature sequence cqu-miR-275

Accession MIMAT0014364
Sequence

62 - 

ucagguaccugaaguagcgc

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).