Stem-loop sequence cqu-mir-1

AccessionMI0013566 (change log)
DescriptionCulex quinquefasciatus miR-1 stem-loop
Gene family MIPF0000038; mir-1
Literature search

3 open access papers mention cqu-mir-1
(6 sentences)

Stem-loop
   g   aa            c        a   -  gauc 
5'  cga  guuccaugcuuc uugcauuc aua gu    u
    |||  |||||||||||| |||||||| ||| ||     
3'  gcu  cgagguaugaag aauguaag uau ca    u
   g   cg            a        g   g  aagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CpipJ1) Overlapping transcripts
supercont3.78: 246202-246278 [+]
intergenic
Database links

Mature sequence cqu-miR-1

Accession MIMAT0014361
Sequence

49 - 

uggaauguaaagaaguauggag

 - 70

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).