Stem-loop sequence cqu-mir-281-1

Accession

MI0013564

Previous IDs

cqu-mir-281

Description

Culex quinquefasciatus miR-281-1 stem-loop

Gene family

MIPF0000087; mir-46

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-46/mir-47/mir-281_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

In molecular biology, mir-46 (MI0000017) and mir-47 (MI0000018) are microRNA expressed in C. elegans from related hairpin precursor sequences. The predicted hairpin precursor sequences for Drosophila mir-281 (MI0000366, MI0000370) are also related and, hence, belong to this family. The hairpin precursors (represented here) are predicted based on base pairing and cross-species conservation; their extents are not known. In this case, the mature sequences are expressed from the 3' arms of the hairpin precursors.

Stem-loop

uu   --c   u      -   aaa           -ua     c      ag ga 
  cug   agu ucgaau gug   auaaagagagc   uccgu gacagu  g  u
  |||   ||| |||||| |||   |||||||||||   ||||| ||||||  |  a
  gac   uua agcuua cau   uauuucucucg   aggua cuguca  u  u
-u   aac   u      a   --g           uua     -      cu ag 

Deep sequencing

9428 reads, 1 experiments

Genome context

• Coordinates (CpipJ1): supercont3.1661: 13232-13338 [+]
• Overlapping transcripts:

  intergenic

Mature sequence cqu-miR-281-5p

• Accession: MIMAT0014358
• Previous IDs: cqu-miR-281
• Sequence: 26 - aagagagcuauccgucgacagu - 47
• Deep sequencing: 9334 reads, 1 experiments
• Evidence: experimental; Solexa [1]

Mature sequence cqu-miR-281-3p

• Accession: MIMAT0014359
• Previous IDs: cqu-miR-281*
• Sequence: 63 - ugucauggaauugcucucuuu - 83
• Deep sequencing: 94 reads, 1 experiments
• Evidence: experimental; Solexa [1]

References

1. PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).