Stem-loop sequence cqu-mir-iab-4

AccessionMI0013563 (change log)
DescriptionCulex quinquefasciatus miR-iab-4 stem-loop
Gene family MIPF0000151; mir-iab-4
Stem-loop
   gc          a  -a            u    c   ag  c 
5'   guacugcuuc ug  acguauacugaa guau cug  ug u
     |||||||||| ||  |||||||||||| |||| |||  || a
3'   cauggcggag ac  ugcauaugacuu caua ggc  au u
   ua          g  aa            c    u   cu  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CpipJ1) Overlapping transcripts
supercont3.12: 681147-681234 [+]
intergenic
Database links

Mature sequence cqu-miR-iab-4

Accession MIMAT0014357
Sequence

17 - 

acguauacugaauguauccuga

 - 38

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).