Stem-loop sequence ghr-MIR399d

AccessionMI0013557 (change log)
DescriptionGossypium hirsutum miR399d stem-loop
Gene family MIPF0000015; MIR399
Literature search

12 open access papers mention ghr-MIR399d
(35 sentences)

Stem-loop
   u   -    ua        c       aa      a     -    uuu 
5'  gag gaau  cagggcaa ucuccuu  gcaaaa uggau gugc   u
    ||| ||||  |||||||| |||||||  |||||| ||||| ||||    
3'  cuc cuua  gucccguu agaggaa  cguuuu gcuua uacg   c
   a   a    cc        u       ac      a     a    uuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ghr-miR399d

Accession MIMAT0014350
Sequence

67 - 

ugccaaaggagauuugcccug

 - 87

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:19889219 "Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L.)" Pang M, Woodward AW, Agarwal V, Guan X, Ha M, Ramachandran V, Chen X, Triplett BA, Stelly DM, Chen ZJ Genome Biol. 10:R122(2009).