Stem-loop sequence ghr-MIR399c

AccessionMI0013556 (change log)
DescriptionGossypium hirsutum miR399c stem-loop
Gene family MIPF0000015; MIR399
Literature search

13 open access papers mention ghr-MIR399c
(35 sentences)

Stem-loop
         -u    g a         ----- g     aac 
5' agggcu  cucu c uuggcaggu     a augau   u
   ||||||  |||| | |||||||||     | |||||    
3' uuccgg  gaga g aaccgucca     u uacua   c
         uu    g a         auuga g     cac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ghr-miR399c

Accession MIMAT0014349
Sequence

54 - 

ugccaaaggagaguuggccuu

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:19889219 "Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L.)" Pang M, Woodward AW, Agarwal V, Guan X, Ha M, Ramachandran V, Chen X, Triplett BA, Stelly DM, Chen ZJ Genome Biol. 10:R122(2009).