Stem-loop sequence aae-mir-iab-4-2

AccessionMI0013531 (change log)
DescriptionAedes aegypti miR-iab-4-2 stem-loop
Gene family MIPF0000151; mir-iab-4
Stem-loop
        a  -a            u    c   ag  c 
5' gcuuc ug  acguauacugaa guau cug  ug u
   ||||| ||  |||||||||||| |||| |||  || a
3' cggag ac  ugcauaugacuu caua ggc  au u
        g  aa            c    u   cu  c 
Get sequence
Deep sequencing
126 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.708: 50256-50329 [+]
intergenic
Database links

Mature sequence aae-miR-iab-4-5p

Accession MIMAT0014278
Sequence

10 - 

acguauacugaauguauccuga

 - 31

Get sequence
Deep sequencing248 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

Mature sequence aae-miR-iab-4-3p

Accession MIMAT0016977
Sequence

44 - 

cgguauaccuucaguauacguaac

 - 67

Get sequence
Deep sequencing4 reads, 1 experiments
Evidence experimental; 454 [1]

References

1
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).