Stem-loop sequence aae-mir-9b

Accession MI0013530
Description Aedes aegypti miR-9b stem-loop
Gene family MIPF0000014; mir-9
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-9/mir-79_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-9 microRNA (homologous to miR-79), is a short non-coding RNA gene involved in gene regulation. The mature ~21nt miRNAs are processed from hairpin precursor sequences by the Dicer enzyme. The dominant mature miRNA sequence is processed from the 5' arm of the mir-9 precursor, and from the 3' arm of the mir-79 precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. In vertebrates, miR-9 is highly expressed in the brain, and is suggested to regulate neuronal differentiation. A number of specific targets of miR-9 have been proposed, including the transcription factor REST and its partner CoREST.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
    -         auc         uuu          ----u  ua 
ucac guuuauugg   uuuggugau   agcuguaugc     ga  c
|||| |||||||||   |||||||||   ||||||||||     ||   
agug uaaguaauc   aaaccacua   ucgauauacg     cu  g
    g         caa         -uu          uuagu  uu 
Get sequence
Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.785: 213570-213661 [+]
intergenic
Clustered miRNAs
< 10kb from aae-mir-9b
aae-mir-306 supercont1.785: 213059-213187 [+]
aae-mir-79 supercont1.785: 213262-213357 [+]
aae-mir-9b supercont1.785: 213570-213661 [+]

Mature sequence aae-miR-9b

Accession MIMAT0014324
Sequence

15 - 

ucuuuggugauuuuagcuguaugc

 - 38

Get sequence
Evidence experimental; 454 [1]

References

1