Stem-loop sequence aae-mir-9b

AccessionMI0013530 (change log)
DescriptionAedes aegypti miR-9b stem-loop
Gene family MIPF0000014; mir-9
Literature search

3 open access papers mention aae-mir-9b
(9 sentences)

Stem-loop
       -         auc         uuu          ----u  ua 
5' ucac guuuauugg   uuuggugau   agcuguaugc     ga  c
   |||| |||||||||   |||||||||   ||||||||||     ||   
3' agug uaaguaauc   aaaccacua   ucgauauacg     cu  g
       g         caa         -uu          uuagu  uu 
Get sequence
Deep sequencing
1029 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.785: 213570-213661 [+]
intergenic
Clustered miRNAs
< 10kb from aae-mir-9b
aae-mir-306supercont1.785: 213059-213187 [+]
aae-mir-79supercont1.785: 213262-213357 [+]
aae-mir-9bsupercont1.785: 213570-213661 [+]
Database links

Mature sequence aae-miR-9b

Accession MIMAT0014324
Sequence

15 - 

ucuuuggugauuuuagcuguaugc

 - 38

Get sequence
Deep sequencing1025 reads, 2 experiments
Evidence experimental; 454 [1]

References

1