Stem-loop sequence aae-mir-9a-1

AccessionMI0013528 (change log)
DescriptionAedes aegypti miR-9a-1 stem-loop
Gene family MIPF0000014; mir-9
Literature search

3 open access papers mention aae-mir-9a-1
(9 sentences)

Stem-loop
        -a   cu       uau      g     -  gaa 
5' gucaa  guu  cuuuggu   cuagcu uauga gu   u
   |||||  |||  |||||||   |||||| ||||| ||   u
3' caguu  uaa  gaagcca   gaucga auacu ca   u
        ga   uu       uac      a     a  aga 
Get sequence
Deep sequencing
26228 reads, 1.3e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.517: 555107-555187 [+]
intergenic
Database links

Mature sequence aae-miR-9a

Accession MIMAT0014323
Sequence

11 - 

ucuuugguuaucuagcuguauga

 - 33

Get sequence
Deep sequencing50990 reads, 2 experiments
Evidence experimental; 454 [1]

References

1