Stem-loop sequence aae-mir-2945

AccessionMI0013522 (change log)
DescriptionAedes aegypti miR-2945 stem-loop
Gene family MIPF0000184; mir-279
Literature search

2 open access papers mention aae-mir-2945
(3 sentences)

Stem-loop
   -   -              c       gu      ugc   au 
5'  ucu gaucugagcggguc guuucua  gucaug   ugu  u
    ||| |||||||||||||| |||||||  ||||||   |||   
3'  ggg cuggauuugcucag cggagau  caguac   aua  c
   a   u              a       --      --u   ag 
Get sequence
Deep sequencing
323225 reads, 1.62e+04 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.43: 958687-958768 [+]
intergenic
Database links

Mature sequence aae-miR-2945-5p

Accession MIMAT0014315
Previous IDsaae-miR-2945*
Sequence

10 - 

agcggguccguuucuagugucaug

 - 33

Get sequence
Deep sequencing158 reads, 2 experiments
Evidence experimental; 454 [1]

Mature sequence aae-miR-2945-3p

Accession MIMAT0014316
Previous IDsaae-miR-2945
Sequence

52 - 

ugacuagaggcagacucguuua

 - 73

Get sequence
Deep sequencing323067 reads, 2 experiments
Evidence experimental; 454 [1]

References

1