Stem-loop sequence aae-mir-286a

AccessionMI0013521 (change log)
DescriptionAedes aegypti miR-286a stem-loop
Gene family MIPF0000225; mir-286
Literature search

2 open access papers mention aae-mir-286a
(3 sentences)

Stem-loop
        ua         --au   -   a          cguacaaaacg 
5' aucgu  uuuggggcg    ugu cgg cuagucgcug           g
   |||||  |||||||||    ||| ||| ||||||||||            
3' uagca  aaauccugc    aca gcc gaucagugau           a
        cg         gcuc   a   a          caacuuuauca 
Get sequence
Deep sequencing
5 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.464: 824995-825091 [+]
intergenic
Clustered miRNAs
< 10kb from aae-mir-286a
aae-mir-286asupercont1.464: 824995-825091 [+]
aae-mir-2944bsupercont1.464: 825313-825374 [+]
aae-mir-2944asupercont1.464: 825450-825511 [+]
aae-mir-309bsupercont1.464: 825629-825699 [+]
Database links

Mature sequence aae-miR-286a

Accession MIMAT0014314
Sequence

63 - 

ugacuagaccgaacacucgcguccu

 - 87

Get sequence
Deep sequencing3 reads, 1 experiments
Evidence experimental; 454 [1]

References

1