Stem-loop sequence aae-mir-286b-2

AccessionMI0013520 (change log)
DescriptionAedes aegypti miR-286b-2 stem-loop
Gene family MIPF0000225; mir-286
Literature search

3 open access papers mention aae-mir-286b-2
(7 sentences)

Stem-loop
      u      --    u   -   cu         uaucauuuc        
5' aag ccuggg  gcga ugu cgg  uagucgcug         aacugcu 
   ||| ||||||  |||| ||| |||  |||||||||         |||||| g
3' uuc ggaccc  ugcu aca gcc  aucagugau         uugacgu 
      c      ua    c   a   ag         ---cgcuuc        
Get sequence
Deep sequencing
3 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.602: 93476-93572 [+]
intergenic
Clustered miRNAs
< 10kb from aae-mir-286b-2
aae-mir-286b-2supercont1.602: 93476-93572 [+]
aae-mir-309a-2supercont1.602: 94025-94115 [+]
Database links

Mature sequence aae-miR-286b

Accession MIMAT0014313
Sequence

66 - 

ugacuagaccgaacacucguauccc

 - 90

Get sequence
Deep sequencing6 reads, 1 experiments
Evidence experimental; 454 [1]

References

1