Stem-loop sequence aae-mir-282-2

AccessionMI0013518 (change log)
DescriptionAedes aegypti miR-282-2 stem-loop
Gene family MIPF0000150; mir-282
Literature search

2 open access papers mention aae-mir-282-2
(4 sentences)

Stem-loop
   aucguc     -ca    -c  ---a     gua           cc      u      uuac  uccu   g 
5'       aucgu   ucgu  gc    caggu   aucuagccucu  uaggcu ugucug    cu    ugg a
         |||||   ||||  ||    |||||   |||||||||||  |||||| ||||||    ||    ||| a
3'       uggca   ggca  ug    gucua   uggauuggaga  guccga acagac    ga    acc u
   ------     acc    ac  aaaa     aag           ca      u      ---c  --uc   u 
Get sequence
Deep sequencing
85 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.377: 313203-313337 [-]
intergenic
Database links

Mature sequence aae-miR-282-5p

Accession MIMAT0014311
Previous IDsaae-miR-282
Sequence

29 - 

aaucuagccucuccuaggcuuugucug

 - 55

Get sequence
Deep sequencing118 reads, 2 experiments
Evidence experimental; 454 [1]

Mature sequence aae-miR-282-3p

Accession MIMAT0014312
Previous IDsaae-miR-282*
Sequence

85 - 

acauagccugacagagguuagg

 - 106

Get sequence
Deep sequencing38 reads, 2 experiments
Evidence experimental; 454 [1]

References

1