Stem-loop sequence aae-mir-307

AccessionMI0013501 (change log)
DescriptionAedes aegypti miR-307 stem-loop
Gene family MIPF0000293; mir-67
Stem-loop
   cuaguuuc   g      a  a         ccu  g       c  a 
5'         ccg cagucg uc cucacucaa   gg ugugaug uu u
           ||| |||||| || |||||||||   || ||||||| || u
3'         ggu guuagc ag gagugaguu   cc acacuac aa u
   --------   a      c  c         ccu  a       u  g 
Get sequence
Deep sequencing
1326 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.16: 1859419-1859509 [-]
intergenic
Database links

Mature sequence aae-miR-307

Accession MIMAT0014296
Sequence

59 - 

cacaaccuccuugagugagcga

 - 80

Get sequence
Deep sequencing1203 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

References

1
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).