Stem-loop sequence aae-mir-79

Accession MI0013500
Description Aedes aegypti miR-79 stem-loop
Gene family MIPF0000014; mir-9
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-9/mir-79_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-9 microRNA (homologous to miR-79), is a short non-coding RNA gene involved in gene regulation. The mature ~21nt miRNAs are processed from hairpin precursor sequences by the Dicer enzyme. The dominant mature miRNA sequence is processed from the 5' arm of the mir-9 precursor, and from the 3' arm of the mir-79 precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. In vertebrates, miR-9 is highly expressed in the brain, and is suggested to regulate neuronal differentiation. A number of specific targets of miR-9 have been proposed, including the transcription factor REST and its partner CoREST.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
----gaa    --ucg            cgc       g     uagaau 
       ccca     uccaugcuuugg   uuuagcu uauga      u
       ||||     ||||||||||||   ||||||| |||||       
       gggu     agguacgaaacc   agaucga auacu      u
cuguggc    ucgga            auu       a     uuauaa 
Get sequence
Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.785: 213262-213357 [+]
intergenic
Clustered miRNAs
< 10kb from aae-mir-79
aae-mir-306 supercont1.785: 213059-213187 [+]
aae-mir-79 supercont1.785: 213262-213357 [+]
aae-mir-9b supercont1.785: 213570-213661 [+]

Mature sequence aae-miR-79-5p

Accession MIMAT0014294
Previous IDs aae-miR-79
Sequence

16 - 

gcuuuggcgcuuuagcuguauga

 - 38

Get sequence
Evidence experimental; 454 [1], Solexa [2]

Mature sequence aae-miR-79-3p

Accession MIMAT0014295
Previous IDs aae-miR-79*
Sequence

56 - 

uaaagcuagauuaccaaagcau

 - 77

Get sequence
Evidence experimental; Solexa [2]

References

1
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).