Stem-loop sequence aae-mir-79

AccessionMI0013500 (change log)
DescriptionAedes aegypti miR-79 stem-loop
Gene family MIPF0000014; mir-9
Literature search

3 open access papers mention aae-mir-79
(7 sentences)

Stem-loop
   ----gaa    --ucg            cgc       g     uagaau 
5'        ccca     uccaugcuuugg   uuuagcu uauga      u
          ||||     ||||||||||||   ||||||| |||||       
3'        gggu     agguacgaaacc   agaucga auacu      u
   cuguggc    ucgga            auu       a     uuauaa 
Get sequence
Deep sequencing
6621 reads, 250 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.785: 213262-213357 [+]
intergenic
Clustered miRNAs
< 10kb from aae-mir-79
aae-mir-306supercont1.785: 213059-213187 [+]
aae-mir-79supercont1.785: 213262-213357 [+]
aae-mir-9bsupercont1.785: 213570-213661 [+]
Database links

Mature sequence aae-miR-79-5p

Accession MIMAT0014294
Previous IDsaae-miR-79
Sequence

16 - 

gcuuuggcgcuuuagcuguauga

 - 38

Get sequence
Deep sequencing36 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

Mature sequence aae-miR-79-3p

Accession MIMAT0014295
Previous IDsaae-miR-79*
Sequence

56 - 

uaaagcuagauuaccaaagcau

 - 77

Get sequence
Deep sequencing6585 reads, 2 experiments
Evidence experimental; Illumina [2]

References

1
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).