|
miRBase |
|
Stem-loop sequence aae-mir-100 |
|||||
| Accession | MI0013497 | ||||
| Description | Aedes aegypti miR-100 stem-loop | ||||
| Gene family | MIPF0000025; mir-99 | ||||
| Stem-loop |
uag ------ cc u a g aa - - ccg gcg ugguug uaguua cauu gcagga cccgua auccg cuugug c ug u ||| |||||| |||||| |||| |||||| |||||| ||||| |||||| | || ugu gcuagc aucggu guag cgucuu ggguau uaggc gaacau g ac u uua uacgaa au c a g aa u u acu |
||||
| Comments |
This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2]. |
||||
| Genome context |
|
||||
Mature sequence aae-miR-100 |
|
| Accession | MIMAT0014291 |
| Sequence |
31 - aacccguagauccgaacuugug - 52 |
| Evidence | experimental; 454 [1], Solexa [2] |
References |
|
| 1 | |
| 2 |
PMID:20167119
"Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus"
BMC Genomics. 11:119(2010).
|