Stem-loop sequence aae-mir-100

AccessionMI0013497 (change log)
DescriptionAedes aegypti miR-100 stem-loop
Gene family MIPF0000033; mir-10
Literature search

3 open access papers mention aae-mir-100
(4 sentences)

Stem-loop
      uag      ------      cc    u      a      g     aa      - -  ccg 
5' gcg   ugguug      uaguua  cauu gcagga cccgua auccg  cuugug c ug   u
   |||   ||||||      ||||||  |||| |||||| |||||| |||||  |||||| | ||    
3' ugu   gcuagc      aucggu  guag cgucuu ggguau uaggc  gaacau g ac   u
      uua      uacgaa      au    c      a      g     aa      u u  acu 
Get sequence
Deep sequencing
53592 reads, 2.6e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.43: 1142154-1142279 [+]
intergenic
Database links

Mature sequence aae-miR-100

Accession MIMAT0014291
Sequence

31 - 

aacccguagauccgaacuugug

 - 52

Get sequence
Deep sequencing24073 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

References

1
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).