Stem-loop sequence aae-mir-279

AccessionMI0013494 (change log)
DescriptionAedes aegypti miR-279 stem-loop
Gene family MIPF0000184; mir-279
Stem-loop
   acaucc    gg    cg         a      uguu     u auuu 
5'       caac  uugu  augggugug aucuag    ucaca g    u
         ||||  ||||  ||||||||| ||||||    ||||| |    c
3'       guug  aaca  uacucacac uagauc    agugu c    g
   --ggcc    aa    au         c      ----     c gaua 
Get sequence
Deep sequencing
37695 reads, 1.9e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.437: 572245-572339 [-]
intergenic
Clustered miRNAs
< 10kb from aae-mir-279
aae-mir-279supercont1.437: 572245-572339 [-]
aae-mir-996supercont1.437: 567493-567590 [-]
Database links

Mature sequence aae-miR-279

Accession MIMAT0014288
Sequence

61 - 

ugacuagauccacacucauuaa

 - 82

Get sequence
Deep sequencing37644 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

References

1
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).