Stem-loop sequence aae-mir-2941-1

Accession MI0013491
Description Aedes aegypti miR-2941-1 stem-loop
Gene family MIPF0000842; mir-2941
Stem-loop 
aug     a     acc  u       -ug     a         ugauuuuu 
   gauua guugu   ac uucgugg   uuuag cguauuaca        u
   ||||| |||||   || |||||||   ||||| |||||||||         
   cugau uaacg   ug aggcacc   agauc gcaugaugu        g
cua     a     -gu  u       uca     g         caauacaa
Get sequence
Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.385: 413127-413232 [-]
intergenic
Clustered miRNAs
< 10kb from aae-mir-2941-1
aae-mir-2946 supercont1.385: 413565-413652 [-]
aae-mir-2941-2 supercont1.385: 413436-413530 [-]
aae-mir-2941-1 supercont1.385: 413127-413232 [-]

Mature sequence aae-miR-2941

Accession MIMAT0014286
Sequence

65 -  

uaguacggcuagaacuccacgg

 - 86

Get sequence
Evidence experimental; 454 [1], Solexa [2]

References

1
PMID:19961592 "Direct sequencing and expression analysis of a large number of miRNAs in Aedes aegypti and a multi-species survey of novel mosquito miRNAs" Li S, Mead EA, Liang S, Tu Z BMC Genomics. 10:581(2009).
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).