|
miRBase |
|
Stem-loop sequence aae-mir-2765 |
|||||
| Accession | MI0013490 | ||||
| Description | Aedes aegypti miR-2765 stem-loop | ||||
| Gene family | MIPF0001008; mir-2765 | ||||
| Stem-loop |
-a uc a c u - ca gaua aacguu cgg gc ugg aacucca c ccguuggc u |||||| ||| || ||| ||||||| | |||||||| u uugcaa gcc ug gcc uugaggu g gguaaccg u ac -- g c c c ag acag |
||||
| Comments |
This miRNA was experimentally identified in the closely related Aedes albopictus, for which there was no genome sequence, and therefore mapped to the Aedes aegypti genome [1]. |
||||
| Genome context |
|
||||
Mature sequence aae-miR-2765 |
|
| Accession | MIMAT0014285 |
| Sequence |
17 - ugguaacuccaccaccguuggc - 38 |
| Evidence | experimental; Solexa [1] |
References |
|
| 1 |
PMID:20167119
"Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus"
BMC Genomics. 11:119(2010).
|