Stem-loop sequence aae-mir-31

AccessionMI0013483 (change log)
DescriptionAedes aegypti miR-31 stem-loop
Gene family MIPF0000064; mir-31
Literature search

3 open access papers mention aae-mir-31
(4 sentences)

Stem-loop
   cgag   u       u  -aagg    guuug   agug       -caacuu       u     c         agu 
5'     auu ugggaga ug     ucgu     cag    aaauugg       ggcaaga guugg auagcugaa   u
       ||| ||||||| ||     ||||     |||    |||||||       ||||||| ||||| |||||||||   u
3'     uag gccuuuu gc     agca     guu    uuuaacc       cuguucu caacu uaucgauuu   u
   ----   u       u  ggaga    --aca   ---a       uuuuuau       u     -         gag 
Get sequence
Deep sequencing
34253 reads, 1.8e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.636: 483181-483329 [-]
intergenic
Database links

Mature sequence aae-miR-31

Accession MIMAT0014276
Sequence

51 - 

uggcaagauguuggcauagcuga

 - 73

Get sequence
Deep sequencing33958 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

References

1
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).