Stem-loop sequence aae-mir-285

AccessionMI0013479 (change log)
DescriptionAedes aegypti miR-285 stem-loop
Gene family MIPF0000009; mir-29
Literature search

3 open access papers mention aae-mir-285
(11 sentences)

Stem-loop
   ---------guu       -  --a       gc   c  a    ag    -  gcau 
5'             aaucuuc cu   aguacug  uuc aa ggug  uaga ug    u
               ||||||| ||   |||||||  ||| || ||||  |||| ||     
3'             uuagaag gg   ucaugac  aag uu ccac  aucu ac    c
   agugcgucuugu       c  aag       ua   c  a    -g    c  auag 
Get sequence
Deep sequencing
120094 reads, 5.95e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.23: 3339127-3339230 [-]
intergenic
Database links

Mature sequence aae-miR-285

Accession MIMAT0014273
Sequence

57 - 

uagcaccauucgaaaucaguac

 - 78

Get sequence
Deep sequencing119380 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

References

1
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).