Stem-loop sequence aae-mir-932

AccessionMI0013475 (change log)
DescriptionAedes aegypti miR-932 stem-loop
Gene family MIPF0000588; mir-932
Literature search

2 open access papers mention aae-mir-932
(7 sentences)

Stem-loop
   -gua     --     a      a       g   a       g  - u 
5'     aucau  agaau gcuuca uuccgua ugc uugcagu ug c u
       |||||  ||||| |||||| ||||||| ||| ||||||| || |  
3'     uagua  ucuua cgaagu aaggugu acg aacguca gc g u
   cuac     ac     g      g       a   -       a  a a 
Get sequence
Deep sequencing
97883 reads, 4.65e+03 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.1064: 154098-154192 [-]
intergenic
Database links

Mature sequence aae-miR-932-5p

Accession MIMAT0014269
Previous IDsaae-miR-932*
Sequence

18 - 

ucaauuccguagugcauugcag

 - 39

Get sequence
Deep sequencing43753 reads, 2 experiments
Evidence experimental; Illumina [2]

Mature sequence aae-miR-932-3p

Accession MIMAT0014270
Previous IDsaae-miR-932
Sequence

56 - 

ugcaagcaauguggaagugaag

 - 77

Get sequence
Deep sequencing54128 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

References

1
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).