Stem-loop sequence aae-mir-315

AccessionMI0013467 (change log)
DescriptionAedes aegypti miR-315 stem-loop
Gene family MIPF0000141; mir-315
Literature search

1 open access papers mention aae-mir-315
(1 sentences)

Stem-loop
   -a      c   aaa                a      ----   gca 
5'   guguuu uau   auuuugauuguugcuc gaaagc    cgu   u
     |||||| |||   |||||||||||||||| ||||||    |||   u
3'   cacaaa aua   ugaaacuaaugacgag cuuucg    gca   u
   ac      -   aac                -      cugg   aag 
Get sequence
Deep sequencing
22216 reads, 1.05e+03 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.612: 104128-104219 [+]
intergenic
Database links

Mature sequence aae-miR-315-5p

Accession MIMAT0014262
Previous IDsaae-miR-315
Sequence

16 - 

uuuugauuguugcucagaaagc

 - 37

Get sequence
Deep sequencing22134 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

Mature sequence aae-miR-315-3p

Accession MIMAT0015370
Previous IDsaae-miR-315*
Sequence

58 - 

cuuucgagcaguaaucaaaguc

 - 79

Get sequence
Deep sequencing77 reads, 2 experiments
Evidence experimental; 454 [1]

References

1
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).