Stem-loop sequence aae-mir-308

Accession

MI0013466 (change log)

Description

Aedes aegypti miR-308 stem-loop

Gene family

MIPF0000171; mir-308

Literature search

2 open access papers mention aae-mir-308
(14 sentences)

Stem-loop

   agcgcug                    gc    u cau  g 
5'        uuucgcgguauauucuugug  uuga g   uu a
          ||||||||||||||||||||  |||| |   ||  
3'        agagugucauaugaggacac  aacu c   aa a
   -----ag                    ua    - --u  a 

Deep sequencing

14793 reads, 700 reads per million, 2 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context

• Coordinates (AaegL1): supercont1.107: 508970-509045 [+]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0013466

Mature sequence aae-miR-308-5p

• Accession: MIMAT0014260
• Previous IDs: aae-miR-308
• Sequence: 11 - cgcgguauauucuuguggcuug - 32
• Deep sequencing: 6572 reads, 2 experiments
• Evidence: experimental; 454 [1], Illumina [2]

Mature sequence aae-miR-308-3p

• Accession: MIMAT0014261
• Previous IDs: aae-miR-308*
• Sequence: 52 - aaucacaggaguauacug - 69
• Deep sequencing: 8221 reads, 2 experiments
• Evidence: experimental; 454 [1], Illumina [2]

References

1. PMID:19961592 "Direct sequencing and expression analysis of a large number of miRNAs in Aedes aegypti and a multi-species survey of novel mosquito miRNAs" Li S, Mead EA, Liang S, Tu Z BMC Genomics. 10:581(2009).
2. PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).