![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence aae-mir-308 |
|||||
Accession | MI0013466 (change log) | ||||
Description | Aedes aegypti miR-308 stem-loop | ||||
Gene family | MIPF0000171; mir-308 | ||||
Literature search |
![]()
2 open access papers mention aae-mir-308 | ||||
Stem-loop |
agcgcug gc u cau g 5' uuucgcgguauauucuugug uuga g uu a |||||||||||||||||||| |||| | || 3' agagugucauaugaggacac aacu c aa a -----ag ua - --u a |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence aae-miR-308-5p |
|
Accession | MIMAT0014260 |
Previous IDs | aae-miR-308 |
Sequence |
11 - cgcgguauauucuuguggcuug - 32 |
Deep sequencing | 6572 reads, 2 experiments |
Evidence | experimental; 454 [1], Illumina [2] |
Mature sequence aae-miR-308-3p |
|
Accession | MIMAT0014261 |
Previous IDs | aae-miR-308* |
Sequence |
52 - aaucacaggaguauacug - 69 |
Deep sequencing | 8221 reads, 2 experiments |
Evidence | experimental; 454 [1], Illumina [2] |
References |
|
1 | |
2 |
PMID:20167119
"Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus"
BMC Genomics. 11:119(2010).
|