Stem-loop sequence aae-mir-308

AccessionMI0013466 (change log)
DescriptionAedes aegypti miR-308 stem-loop
Gene family MIPF0000171; mir-308
Literature search

2 open access papers mention aae-mir-308
(14 sentences)

Stem-loop
   agcgcug                    gc    u cau  g 
5'        uuucgcgguauauucuugug  uuga g   uu a
          ||||||||||||||||||||  |||| |   ||  
3'        agagugucauaugaggacac  aacu c   aa a
   -----ag                    ua    - --u  a 
Get sequence
Deep sequencing
14793 reads, 700 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.107: 508970-509045 [+]
intergenic
Database links

Mature sequence aae-miR-308-5p

Accession MIMAT0014260
Previous IDsaae-miR-308
Sequence

11 - 

cgcgguauauucuuguggcuug

 - 32

Get sequence
Deep sequencing6572 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

Mature sequence aae-miR-308-3p

Accession MIMAT0014261
Previous IDsaae-miR-308*
Sequence

52 - 

aaucacaggaguauacug

 - 69

Get sequence
Deep sequencing8221 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

References

1
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).