Stem-loop sequence aae-mir-125

AccessionMI0013465 (change log)
DescriptionAedes aegypti miR-125 stem-loop
Gene family MIPF0000033; mir-10
Literature search

1 open access papers mention aae-mir-125
(4 sentences)

Stem-loop
   uu       uuu        uc  u    c cu         --  aua 
5'   aguuuug   cugcugau  cc gaga c  aacuuguga  cu   g
     |||||||   ||||||||  || |||| |  |||||||||  ||    
3'   uuagagc   ggcgauua  gg cucu g  uugaacacu  ga   u
   ac       --u        -u  c    a uu         uu  agu 
Get sequence
Deep sequencing
68185 reads, 3.3e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.43: 1156595-1156689 [+]
intergenic
Clustered miRNAs
< 10kb from aae-mir-125
aae-let-7supercont1.43: 1156326-1156396 [+]
aae-mir-125supercont1.43: 1156595-1156689 [+]
Database links

Mature sequence aae-miR-125-5p

Accession MIMAT0014258
Previous IDsaae-miR-125
Sequence

21 - 

ucccugagacccuaacuuguga

 - 42

Get sequence
Deep sequencing62157 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

References

1
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).