Stem-loop sequence aae-mir-13

AccessionMI0013463 (change log)
DescriptionAedes aegypti miR-13 stem-loop
Gene family MIPF0000049; mir-2
Stem-loop
   guc u       -    a            c    uu   a g 
5'    g gaucgga ucgu aaaaugguugug ugug  guu c c
      | ||||||| |||| |||||||||||| ||||  ||| |  
3'    c cuagcuu agca uuuuaccgacac auac  uaa g u
   -gu -       g    g            u    -u   a c 
Get sequence
Deep sequencing
15763 reads, 650 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.268: 888736-888819 [-]
intergenic
Clustered miRNAs
< 10kb from aae-mir-13
aae-mir-71supercont1.268: 889378-889454 [-]
aae-mir-2csupercont1.268: 889085-889162 [-]
aae-mir-13supercont1.268: 888736-888819 [-]
aae-mir-2asupercont1.268: 888581-888677 [-]
aae-mir-2bsupercont1.268: 887244-887330 [-]
Database links

Mature sequence aae-miR-13-5p

Accession MIMAT0014255
Previous IDsaae-miR-13*
Sequence

13 - 

ucguaaaaaugguugugcugug

 - 34

Get sequence
Deep sequencing2925 reads, 2 experiments
Evidence experimental; Illumina [2]

Mature sequence aae-miR-13-3p

Accession MIMAT0014256
Previous IDsaae-miR-13
Sequence

54 - 

uaucacagccauuuugacgaguu

 - 76

Get sequence
Deep sequencing12834 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

References

1
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).