Stem-loop sequence aae-mir-12

AccessionMI0013462 (change log)
DescriptionAedes aegypti miR-12 stem-loop
Gene family MIPF0000181; mir-12
Literature search

6 open access papers mention aae-mir-12
(79 sentences)

Stem-loop
   uu    cu      u    c          ------     ---u      a  ac 
5'   cgga  gaguau acau agguacuggu      gucga    auucga uc  c
     ||||  |||||| |||| ||||||||||      |||||    |||||| ||   
3'   gccu  cucgua ugua uucaugacca      uaguu    ugggcu ag  a
   --    cu      u    -          uucaau     uccu      a  ca 
Get sequence
Deep sequencing
22376 reads, 1.05e+03 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.68: 2720396-2720497 [-]
intergenic
Clustered miRNAs
< 10kb from aae-mir-12
aae-mir-283supercont1.68: 2729329-2729431 [-]
aae-mir-1889supercont1.68: 2720794-2720921 [-]
aae-mir-12supercont1.68: 2720396-2720497 [-]
Database links

Mature sequence aae-miR-12-5p

Accession MIMAT0014253
Previous IDsaae-miR-12
Sequence

8 - 

ugaguauuacaucagguacuggu

 - 30

Get sequence
Deep sequencing22291 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

Mature sequence aae-miR-12-3p

Accession MIMAT0014254
Previous IDsaae-miR-12*
Sequence

78 - 

caguacuuauguuaugcucucu

 - 99

Get sequence
Deep sequencing85 reads, 2 experiments
Evidence experimental; Illumina [2]

References

1
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).