Stem-loop sequence aae-mir-34

AccessionMI0013456 (change log)
DescriptionAedes aegypti miR-34 stem-loop
Gene family MIPF0000039; mir-34
Literature search

5 open access papers mention aae-mir-34
(22 sentences)

Stem-loop
   caa    aua   ua      u    u   c        uagaacu  ggg           -    u 
5'    ggca   cgc  uggcag gugg uag ugguugug       uu   gggcuuccgug gcgu c
      ||||   |||  |||||| |||| ||| ||||||||       ||   ||||||||||| ||||  
3'    ccgu   gcg  gccguc cgcc auc accaacac       ag   cucgggggcac cgcg g
   gga    gga   cc      c    u   -        -----uu  --a           a    c 
Get sequence
Deep sequencing
939266 reads, 4.56e+04 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.265: 509521-509649 [+]
intergenic
Clustered miRNAs
< 10kb from aae-mir-34
aae-mir-277supercont1.265: 508799-508893 [+]
aae-mir-34supercont1.265: 509521-509649 [+]
Database links

Mature sequence aae-miR-34-5p

Accession MIMAT0014245
Previous IDsaae-miR-34
Sequence

16 - 

uggcagugugguuagcugguug

 - 37

Get sequence
Deep sequencing937694 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

Mature sequence aae-miR-34-3p

Accession MIMAT0014246
Previous IDsaae-miR-34*
Sequence

94 - 

caaccacuauccgcccugccgcc

 - 116

Get sequence
Deep sequencing1228 reads, 2 experiments
Evidence experimental; Illumina [2]

References

1
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).