Stem-loop sequence aae-mir-34

Accession MI0013456
Description Aedes aegypti miR-34 stem-loop
Gene family MIPF0000039; mir-34
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-34_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The mir-34 microRNA precursor family are non-coding RNA molecules that, in mammals, give rise to three major mature miRNAs. The miR-34 family members were discovered computationally and later verified experimentally. The precursor miRNA stem-loop is processed in the cytoplasm of the cell, with the predominant miR-34 mature sequence excised from the 5' arm of the hairpin. The mature miR-34a is a part of the p53 tumor suppressor network of proteins; therefore, it is hypothesized that miR-34 dysregulation is involved in the development of some cancers.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
caa    aua   ua      u    u   c        uagaacu  ggg           -    u 
   ggca   cgc  uggcag gugg uag ugguugug       uu   gggcuuccgug gcgu c
   ||||   |||  |||||| |||| ||| ||||||||       ||   ||||||||||| ||||  
   ccgu   gcg  gccguc cgcc auc accaacac       ag   cucgggggcac cgcg g
gga    gga   cc      c    u   -        -----uu  --a           a    c 
Get sequence
Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.265: 509521-509649 [+]
intergenic
Clustered miRNAs
< 10kb from aae-mir-34
aae-mir-277 supercont1.265: 508799-508893 [+]
aae-mir-34 supercont1.265: 509521-509649 [+]

Mature sequence aae-miR-34-5p

Accession MIMAT0014245
Previous IDs aae-miR-34
Sequence

16 - 

uggcagugugguuagcugguug

 - 37

Get sequence
Evidence experimental; 454 [1], Solexa [2]

Mature sequence aae-miR-34-3p

Accession MIMAT0014246
Previous IDs aae-miR-34*
Sequence

94 - 

caaccacuauccgcccugccgcc

 - 116

Get sequence
Evidence experimental; Solexa [2]

References

1
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).