Stem-loop sequence aae-mir-1

AccessionMI0013455 (change log)
DescriptionAedes aegypti miR-1 stem-loop
Gene family MIPF0000038; mir-1
Literature search

7 open access papers mention aae-mir-1
(14 sentences)

Stem-loop
   -   aa            c        a   -  gauu 
5'  cga  guuccaugcuuc uugcauuc aua gu    c
    |||  |||||||||||| |||||||| ||| ||     
3'  gcu  cgagguaugaag aauguaag uau cg    u
   g   cg            a        g   a  aaag 
Get sequence
Deep sequencing
10478449 reads, 5.37e+05 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.812: 291326-291401 [+]
intergenic
Database links

Mature sequence aae-miR-1

Accession MIMAT0014244
Sequence

48 - 

uggaauguaaagaaguauggag

 - 69

Get sequence
Deep sequencing10478431 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

References

1
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).