Stem-loop sequence aae-mir-11

AccessionMI0013453 (change log)
DescriptionAedes aegypti miR-11 stem-loop
Gene family MIPF0000252; mir-11
Literature search

4 open access papers mention aae-mir-11
(7 sentences)

Stem-loop
   ----aaca     --      agug   c          c        cc    uacacuu 
5'         uugau  gcgagu    ccg gcgagaacuc ggcuguga  ugug       u
           |||||  ||||||    ||| |||||||||| ||||||||  ||||        
3'         aacua  ugcucg    ggu cguucuugag cugacacu  acac       a
   agguaauc     gc      --ga   u          u        --    uaaaccu 
Get sequence
Deep sequencing
30277 reads, 1.4e+03 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.744: 321996-322109 [+]
intergenic
Clustered miRNAs
< 10kb from aae-mir-11
aae-mir-11supercont1.744: 321996-322109 [+]
aae-mir-998supercont1.744: 322280-322371 [+]
Database links

Mature sequence aae-miR-11-5p

Accession MIMAT0014241
Previous IDsaae-miR-11*
Sequence

27 - 

agaacuccggcugugaccugug

 - 48

Get sequence
Deep sequencing2428 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

Mature sequence aae-miR-11-3p

Accession MIMAT0014242
Previous IDsaae-miR-11
Sequence

67 - 

caucacagucugaguucuugcu

 - 88

Get sequence
Deep sequencing27849 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

References

1
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).