|
miRBase |
|
Stem-loop sequence aae-mir-278 |
|||||
| Accession | MI0013450 | ||||
| Description | Aedes aegypti miR-278 stem-loop | ||||
| Gene family | MIPF0000155; mir-278 | ||||
| Stem-loop |
--u - u u g -ug auu ggu gcgaacggacga agucu ca cggccg c u ||| |||||||||||| ||||| || |||||| | cca uguuugccugcu ucagg gu gcuggu g g ccg a u - g uaa aua |
||||
| Comments |
This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2]. |
||||
| Genome context |
|
||||
Mature sequence aae-miR-278-5p |
|
| Accession | MIMAT0014237 |
| Previous IDs | aae-miR-278 |
| Sequence |
9 - acggacgauagucuucagcggcc - 31 |
| Evidence | experimental; 454 [1], Solexa [2] |
Mature sequence aae-miR-278-3p |
|
| Accession | MIMAT0014238 |
| Previous IDs | aae-miR-278* |
| Sequence |
51 - ucggugggacuuucguccguuu - 72 |
| Evidence | experimental; Solexa [2] |
References |
|
| 1 | |
| 2 |
PMID:20167119
"Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus"
BMC Genomics. 11:119(2010).
|