Stem-loop sequence aae-mir-278

AccessionMI0013450 (change log)
DescriptionAedes aegypti miR-278 stem-loop
Gene family MIPF0000155; mir-278
Literature search

2 open access papers mention aae-mir-278
(4 sentences)

Stem-loop
   --u   -            u     u  g      -ug auu 
5'    ggu gcgaacggacga agucu ca cggccg   c   u
      ||| |||||||||||| ||||| || ||||||   |    
3'    cca uguuugccugcu ucagg gu gcuggu   g   g
   ccg   a            u     -  g      uaa aua 
Get sequence
Deep sequencing
2501 reads, 100 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.16: 3596261-3596341 [+]
intergenic
Database links

Mature sequence aae-miR-278-5p

Accession MIMAT0014237
Previous IDsaae-miR-278
Sequence

9 - 

acggacgauagucuucagcggcc

 - 31

Get sequence
Deep sequencing445 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

Mature sequence aae-miR-278-3p

Accession MIMAT0014238
Previous IDsaae-miR-278*
Sequence

51 - 

ucggugggacuuucguccguuu

 - 72

Get sequence
Deep sequencing2053 reads, 2 experiments
Evidence experimental; Illumina [2]

References

1
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).