Stem-loop sequence aae-mir-281

AccessionMI0013447 (change log)
DescriptionAedes aegypti miR-281 stem-loop
Gene family MIPF0000087; mir-46
Literature search

5 open access papers mention aae-mir-281
(8 sentences)

Stem-loop
   u  -uu      a  aaa           -ua     c      ag ga 
5'  gg   ucgaau ug   auaaagagagc   uccgu gacagu  g  u
    ||   |||||| ||   |||||||||||   ||||| ||||||  |  a
3'  cu   agcuua ac   uauuucucucg   aggua cuguca  u  u
   a  uau      -  aug           uua     -      cu ag 
Get sequence
Deep sequencing
27581 reads, 1.25e+03 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.957: 134442-134538 [+]
intergenic
Database links

Mature sequence aae-miR-281-5p

Accession MIMAT0014231
Previous IDsaae-miR-281
Sequence

21 - 

aagagagcuauccgucgac

 - 39

Get sequence
Deep sequencing27467 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

Mature sequence aae-miR-281-3p

Accession MIMAT0014232
Previous IDsaae-miR-281*
Sequence

58 - 

ugucauggaauugcucucuuua

 - 79

Get sequence
Deep sequencing114 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

References

1
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).